Journal: American journal of transplantation : official journal of the American Society of Transplantation and the American Society of Transplant Surgeons

Article Title: Primary alloproliferative TH1 response induced by immature plasmacytoid dendritic cells in collaboration with myeloid DCs.

doi: 10.1111/j.1600-6143.2005.01097.x

Figure Lengend Snippet: Figure 4: The phenotype of the responder T-cell population is similar in MDC and 5000PDC+100MDC allostimulatory conditions. After 5 days of culture, the alloproliferating CFSE-low T cells were stained with different mAbs to the indicated markers. (A) The expression of IL2Ra, IL12Rb1 and CD154 on proliferating T cells (gated on R1) is shown. The numbers indicate the percentage of cells in each quadrant. (B) Summary of the markers analyzed and detected (+ve) on responding CFSE-low T cells stimulated by 5000MDC (black bars) or 5000PDC+100MDC (white bars) (mean ± SD, n = 4). As most cells expressing the markers are CFSE low, the proportion is calculated based on the proliferating cells (contained in the R2 regions). (C) The time-dependent expression of IL12Rb2 on CFSE-low T cells was analyzed in three different culture experiments stimulated by (5000PDC+100MDC) (white symbols) or 5000MDCs alone (black symbols) for the indicated time period.

Article Snippet: The following murine monoclonal antibodies (mAbs) were used: Peridinin Chlorophyll Protein (PerCP)-labeled CD3 and HLA-DR; Fluorescein isothiocyanate (FITC)-labeled CD4 and CD45RA; Phycoerythrin (PE)-labeled CD11c, CD123, IL2Ra, CD154, CD45RO, IL12Rb1, IL12Rb2, IL18Ra (BD Biosciences Oxford, UK); TRI-Color® (TC)-labeled CD3, PE-labeled IL4, Allophycocyanin (APC)-labeled IFNc (Caltag Laboratories, Hamburg, Germany); FITC-labeled anti-BDCA2 (Miltenyi Biotec, Bergisch Gladbach, Germany); RPE-Cy5-labeled CD14, CD19 (Serotec Ltd, Kidlington, Oxford, UK).

Techniques: Staining, Expressing

Journal: PloS one

Article Title: Association of interleukin-6 signalling with the muscle stem cell response following muscle-lengthening contractions in humans.

doi: 10.1371/journal.pone.0006027

Figure Lengend Snippet: Figure 1. Circulating IL-6 and muscle IL-6 mRNA and IL-6 receptor response muscle lengthening contractions (MLC). (1a) Average serum interleukin-6 (IL-6) concentration. Time 0 hr corresponds to pre-intervention values; all other time-points correspond to post-intervention time (hr). (1b) Relative IL-6 mRNA expression, expressed as fold-change from 0 hr. (1c) Pearson correlation of serum IL-6 concentration versus muscle IL-6 mRNA (fold-change), correlation is representative of the individual data points and presented as mean values ($)6SD (error bars). (1d) Relative IL-6 receptor (IL-6Ra) mRNA expression, expressed as fold-change from 0 hr. (1e) Immunofluorescent image (406) of a muscle cross-section triple-stained for Pax7 (red), IL-6Ra (green) and nuclei (DAPI = blue); IL-6Ra staining is apparent on the sarcolemma and satellite cell membrane. White arrow denotes one of the Pax7+ nuclei which co-localized with IL-6Ra (scale bar = 100 mm). Values are reported as mean6S.E.M. Mean values represent the mean for all 8 subjects per time-point (8 samples per time-point, 40 samples total). *p,0.05 vs. 0 hr. doi:10.1371/journal.pone.0006027.g001

Article Snippet: Immunofluorescence 7 mm sections were cryosectioned and stained with antibodies against Pax7 (neat; DSHB, USA); IL-6 (500 ng/mL, MAB 2061, R&D Systems, USA); p-STAT3 (p-STAT3 Y705 1:100, Cell Signaling Technologies Inc., USA); IL-6Ra (1:50, MCA822, Serotec, UK); PCNA (1:200, ab15497, Abcam Inc., USA); and Laminin (1:1000, L8271, Sigma-Aldrich, Canada).

Techniques: Concentration Assay, Expressing, Staining, Membrane

Journal: Acta Neuropathologica

Article Title: Post-stroke inflammation—target or tool for therapy?

doi: 10.1007/s00401-018-1930-z

Figure Lengend Snippet: Neuroinflammation in the post-ischemic human and murine brain. a – c Immunohistochemical staining of CD45 + ( a ), Iba1 + ( b ), and CD68 + ( c ) microglia/macrophages in human post-mortem ischemic brain tissue. d – i Immunohistochemical staining of TNF + ( d ), TNFR1 + ( e ), TNFR2 + ( f ), IL-1β + ( g ), IL-1α + ( h ), and IL-1Ra + ( i ) cells in human post-mortem ischemic brain tissue. ( j, k ) Immunofluorescence double staining showing co-localization of IL-6 to NeuN + neurons ( j ), but absence of IL-6 to CD11b + microglia/macrophages ( k ) in the murine brain after pMCAO. l Immunofluorescence double staining showing co-localization of IL-6R to NeuN + neurons in the murine brain after pMCAO. Unpublished images of CD45, Iba1, CD68, TNF, TNFR1, TNFR2, and IL-1Ra stained tissue sections were acquired from human post-mortem ischemic brain tissue processed as previously described [ , ] using already published protocols, except for IL-1β and IL-1α. Staining for IL-1β and IL-1α was performed using similar protocols and the following antibodies: Human IL-1α Ab (monoclonal mouse IgG 2A , clone #4414, 1:1,200, R&D Systems) and human IL-1β Ab (monoclonal mouse IgG1, clone #2E8, 1:50, BioRad). Unpublished images of IL-6 and IL-6R co-localized cells were acquired from parallel tissue sections from mice subjected to pMCAO as described in . In images a – i , Toluidine blue was used as a counterstain and in j – l , DAPI was used as a nuclear marker. Scale bars: a , i = 40 μm, j = 20 μm, and k , l = 20 μm. IL interleukin, IL-6R interleukin-6 receptor, TNF tumor necrosis factor, TNFR tumor necrosis factor receptor. The use of human brains was approved by the Danish Biomedical Research Ethical committee for the Region of Southern Denmark (permission number S-20080042) as stated in the original references

Article Snippet: Staining for IL-1β and IL-1α was performed using similar protocols and the following antibodies: Human IL-1α Ab (monoclonal mouse IgG 2A , clone #4414, 1:1,200, R&D Systems) and human IL-1β Ab (monoclonal mouse IgG1, clone #2E8, 1:50, BioRad).

Techniques: Immunohistochemical staining, Staining, Immunofluorescence, Double Staining, Marker

Journal: Acta Neuropathologica

Article Title: Post-stroke inflammation—target or tool for therapy?

doi: 10.1007/s00401-018-1930-z

Figure Lengend Snippet: Studies on anti-cytokine treatments in experimental and human stroke

Article Snippet: Staining for IL-1β and IL-1α was performed using similar protocols and the following antibodies: Human IL-1α Ab (monoclonal mouse IgG 2A , clone #4414, 1:1,200, R&D Systems) and human IL-1β Ab (monoclonal mouse IgG1, clone #2E8, 1:50, BioRad).

Techniques: Injection, Functional Assay, Recombinant, Plasmid Preparation, Clinical Proteomics, Infection

Journal: Acta Neuropathologica

Article Title: Post-stroke inflammation—target or tool for therapy?

doi: 10.1007/s00401-018-1930-z

Figure Lengend Snippet: Mechanistic profile of cytokine and cytokine receptor agonists/antagonists for use in experimental stroke

Article Snippet: Staining for IL-1β and IL-1α was performed using similar protocols and the following antibodies: Human IL-1α Ab (monoclonal mouse IgG 2A , clone #4414, 1:1,200, R&D Systems) and human IL-1β Ab (monoclonal mouse IgG1, clone #2E8, 1:50, BioRad).

Techniques: Bioprocessing, Dominant Negative Mutation, Recombinant

Journal: Acta Neuropathologica

Article Title: Post-stroke inflammation—target or tool for therapy?

doi: 10.1007/s00401-018-1930-z

Figure Lengend Snippet: Temporal profile of cytokine and cytokine receptor upregulation in the acute phase after pMCAO. a Graphical presentation of the temporal profile of TNF, LTα, TNFR1, and TNFR2 mRNAs in the same ischemic hemispheres from mice subjected to pMCAO. b Graphical presentation of the temporal profile of IL-1β, IL-1α, IL-1Ra, IL-1R1, and IL-1R2 mRNAs after pMCAO. c Graphical presentation of the temporal profile of IL-6, IL-6R, and gp130 mRNAs after pMCAO. Data are presented as relative increases in mRNA levels compared with unmanipulated controls. TNF, TNFR1 and TNFR2 mRNA data have been obtained from [ , ], whereas LTα mRNA data are unpublished data performed on the same experimental mice and conditions as . The sequence of the LTα TaqMan probe was AGGAGGGAGTTGTTGCTCAAAGAGAAGCCA, for the LTα sense primer it was CTGCTGCTCACCTTGTTGGG, and for the LTα antisense primer it was TAGAGGCCACTGGTGGGGAT. IL-1α, IL-1β, IL-1Ra, IL-1R1, and IL-1R2 mRNA data have been obtained from . IL-6, IL-6R, and gp130 mRNA data have been obtained from . Note the logarithmic Y axis. gp130 glycoprotein 130, IL interleukin, IL-6R interleukin-6 receptor, LT α lymphotoxin-alpha, TNF tumor necrosis factor, TNFR tumor necrosis factor receptor

Article Snippet: Staining for IL-1β and IL-1α was performed using similar protocols and the following antibodies: Human IL-1α Ab (monoclonal mouse IgG 2A , clone #4414, 1:1,200, R&D Systems) and human IL-1β Ab (monoclonal mouse IgG1, clone #2E8, 1:50, BioRad).

Techniques: Sequencing

Journal: Acta Neuropathologica

Article Title: Post-stroke inflammation—target or tool for therapy?

doi: 10.1007/s00401-018-1930-z

Figure Lengend Snippet: Schematics presenting mechanisms of actions of approved and selected experimental cytokine and cytokine receptor agonists and antagonists. a – c TNF ( a ), IL-1 ( b ), and IL-6 ( c ) signaling via their receptors and mechanisms of actions of approved and selected novel inhibitors. Figures are modified using Protein Lounge Pathway Database ( www.proteinlounge.com ). Ab antibody, gp130 glycoprotein 130, icIL-1Ra intracellular interleukin-1 receptor antagonist, IL interleukin, IL-1Ra interleukin-1 receptor antagonist, IL-1R1 interleukin-1 receptor type 1, IL-1R2 interleukin-1 receptor type 2, IL-1RAcP IL-1 receptor accessory protein, sIL-1RAcP soluble IL-1 receptor accessory protein, IL-6R interleukin-6 receptor, sgp130 soluble glycoprotein 130, solIL-6R soluble interleukin-6 receptor, solTNF soluble tumor necrosis factor, tmTNF transmembrane tumor necrosis factor, TNF tumor necrosis factor, TNFR tumor necrosis factor receptor

Article Snippet: Staining for IL-1β and IL-1α was performed using similar protocols and the following antibodies: Human IL-1α Ab (monoclonal mouse IgG 2A , clone #4414, 1:1,200, R&D Systems) and human IL-1β Ab (monoclonal mouse IgG1, clone #2E8, 1:50, BioRad).

Techniques: Modification